حل أسئلة اختبار مقنن الفصل التاسع ( الوراثة الجزيئية) - العلم نور

جديد

{ وَقُلْ رَبِّ زِدْنِي عِلْمًا }

الخميس، 20 مايو 2021

حل أسئلة اختبار مقنن الفصل التاسع ( الوراثة الجزيئية)

 

بسم الله الرحمن الرحيم

السلام عليكم ورحمة الله وبركاته

حل أسئلة اختبار مقنن الفصل التاسع ( الوراثة الجزيئية)

 

أسئلة الاختيار من متعدد

 

1.  الإنزيم المسؤول عن فك الارتباط بين سلسلتي DNA خلال عملية التضاعف هو:

a.   إنزيم فك التواء DNA.

b.  إنزيم ربط DNA.

c.   إنزيم بلمرة DNA.

d.  إنزيم RNA البادئ.

الحل:

a.     إنزيم فك التواء DNA.

 


استعمل الشكل الآتي للإجابة عن السؤال 2.

 

حل أسئلة اختبار مقنن الفصل التاسع ( الوراثة الجزيئية)

 

 

2.  يوضح الشكل سلسلة DNA، فما سلسلة mRNA المحتمل تكونها في عملية النسخ؟

a.   .5'AATAGAATAGTA3'

b.  .5'AAUAGAAUAGUA3'

c.   .5'ATGATAAGATAA3'

d.  .5'AUGAUAAGAUAA3'

الحل:

d.     .5'AUGAUAAGAUAA3'

 

3.  ما العملية التي تلعب دوراً في التنوع الوراثي؟

a.   التكاثر اللاجنسي.

b.  انقسام السيتوبلازم.

c.   التوزيع الحر.

d.  الانقسام المتساوي.

الحل:

c.     التوزيع الحر.

 

4.  ما كودون الانتهاء في mRNA؟

a.   AUG.

b.  AUU.

c.   CAU.

d.  UAA.

الحل:

d.     UAA.

 

5.  أي مما يأتي يرتبط بتنظيم الجين في الخلايا البدائية النوى؟

a.   السلسلة الثنائية لـ DNA.

b.  البروتينات المثبطة.

c.   تداخل RNA.

d.  عامل النسخ.

الحل:

b.     البروتينات المثبطة.

 

 

6.  قطعة من DNA تحمل التسلسل الآتي: CCCCGAATT، افترض أن طفرة حدثت في هذه القطعة فأصبح التسلسل الجديد CCTCGAATT. فما المصطلح الذي يصف هذه الطفرة؟

a.   طفرة كروموسومية.

b.  طفرة حذف.

c.   طفرة تضاعف.

d.  طفرة استبدال.

الحل:

d.     طفرة استبدال.

 

7.  أين توجد أجسام بار Barr؟

a.   الخلايا الجسمية الأنثوية.

b.  الخلايا الجنسية الأنثوية.

c.   الخلايا الجسمية الذكرية.

d.  الخلايا الجنسية الذكرية.

الحل:

a.   الخلايا الجسمية الأنثوية.

 

 

أسئلة الإجابات القصيرة

 

8.  صف تزاوج نباتي بازلاء كلاهما يحمل صفة البذور الصفراء والملساء غير متماثل الجينات للصفتين (Yy Rr)، مستخدماً قانون التوزيع الحر، واذكر نسبة الطرز الشكلية لهذا التزاوج، مستخدماً مربع بانيت.

الحل:

ينص قانون التوزيع الحر على أنه يحدث توزيع عشوائي للجينات المتقابلة خلال تكوين الأمشاج. لذا فإنه ينتج عن التزاوج بين الصفتين YyRr طرز شكلية بالنسب:

9:3:3:1.

 

Yr

yR

Yr

YR

 

YyRr

YyRR

YYRr

YYRR

YR

Yyrr

YyRr

YYrr

YYRr

Yr

YyRr

yyRR

YyRr

YyRR

yR

Yyrr

yyRr

Yyrr

YyRr

yr

 

 







 

9.  ما الذي قد يسبب تغير لون الفرو في إناث بعض الحيوانات؟ أعط سبباً يدعم استنتاجك.

الحل:

من المحتمل أن تكون اختلافات الفراء التي تحدث فقط في الإناث بسبب "تعويض الجرعة". تعتمد درجة التعبير على عدد الجينات الموجودة في الإناث. من غير المحتمل أن تسبب الجينات المرتبطة مع الجنس هذه الآثار ما لم يتم التعبير عن هذه الجينات أو تكون قاتلة في الذكور.

 

10.                 افترض أنك أجريت تزاوجاً بين مخلوقين حيين كلاهما يحمل الطراز الجيني RrYy. ما نسبة الأفراد الناتجين الذين سيكونون متماثلي الجينات لكلتا الصفتين؟ فسر إجابتك.

الحل:

الطرز الجينية المتماثلة الجينات لكلتا الصفتين، هي:

rryy، rrYY، RRyy، RRYY. تمثل الطرز الجينية المتماثلة %25  من المجموع الكلي. أسهل طريقة لتحديد نبة الأبناء المتماثلي الجينات لكلتا الصفتين يكون بواسطة مربع بانيت.

 

11.                 افترض أن مخلوقاً حياً (عدد الكروموسومات فيه 2n=6) لديه نسخة واحدة من الكروموسوم رقم 3. ماعدد كروموسومات هذا الشخص في المخطط الكروموسومي الخاص به؟ فسر إجابتك.

الحل:

يكون للمخلوق الحي خمسة كروموسومات في مخططه الكروموسومي. أحادي المجموعة الكروموسومية يعني غياب كروموسوم واحد من زوج الكروموسومات. عدد كروموسومات هذا المخلوق 2n = 6، أو ستة كروموسومات. وفقد كروموسوم واحد يعطي مجموعاً مقداره خمسة كروموسومات.

 

12.                 لماذا تكون المناطق المسؤولة عن إنتاج بروتينات متشابهة في معظم البشر؟

الحل:

معظم البروتينات التي تكون الجسم البشري هي نفسها في جميع البشر. والاختلافات الوراثية بين البشر قليلة جداً.

 

13.                 اذكر القواعد البيورينية والقواعد البيريميدينية في DNA؛ وفسر أهميتها في تركيب DNA.

الحل:

        قواعد البيورين: أدينين، جوانين، قواعد البيريميدين: سايتوسين، ثايمين. وترتبط قواعد البيريميدين مع قواعد البيورين في أشرطة DNA على نحو الآتي: أدنين مع ثايمين، وجوانين مع سايتوسين.

 

أسئلة الإجابات المفتوحة

 


استعمل الشكل الآتي للإجابة عن السؤال 14. 

 

مخطط العائلة

 

14.                 صف نمط الوراثة للمرض المبين في مخطط العائلة أعلاه.

الحل:

هذا المرض مرتبط بالجنس والجين المسؤول عنه متنح. وهو مرتبط بالجنس لأن المرض نفسه يظهر على نحو أكبر في الذكور، في حين أن الإناث في العادة تحمل الجين المسبب للمرض فقط، مما يشير إلى أنهن يحملن جيناً آخر سائداً على الكروموسوم X الثاني وبالتالي فهو يخفي أثر جين الإصابة بالمرض. والجين المسبب للمرض في مخطط العائلة هذا متنح؛ لأنه يؤثر في الإناث اللاتي يستقبلن الجين المسبب لهذا المرض من الأبوين كليهما.

 

 

15.                 اذكر نوعين من الطفرات التي تحدث في DNA، ووضح كيف يمكن أن تغير كل واحدة في تسلسل القواعد في القطعة الآتية:

CGATTGACGTTTTAGGAT

الحل:

الطفرة

السلسلة الجديدة

التضاعف

CGATTGTTGACGTTTTAGGAT

الإضافة (إزاحة)

CGAGTTGACGTTTTAGGAT

 

 

 

16.                 فسر دور نشر نتائج الأبحاث في التوصل إلى تركيب DNA.

الحل:

متروك للطالب.

 

أسئلة مقالية

 

في بعض أنواع الدراسات البحثية يشدد الباحثون على وجود تؤائم شقيقة، اعتماداً على نوع الدراسة. وللتوائم أهمية كبيرة في الدراسات والأبحاث التي تتعلق بالوراثة.

استخدم المعلومات الواردة في الفقرة أعلاه للإجابة عن السؤال الآتي في صورة مقالة.

17.                 تخيل أنك عالم تقويم ببحث، واكتب خطة دراسة بحثية تتطلب وجود توائم مشاركين فيها. وفسر ما تحاول دراسته، وما إذا كنت ترغب في دراسة توائم متطابقة أو شقيقة، وما أهمية وجود التوائم في دراستك؟

الحل:

متروك للطالب.

 

 

 

 

تم بحمد الله

 

نستقبل أسئلتكم واستفساراتكم واقتراحاتكم في خانة التعليقات

"نرد على جميع التعليقات"

 

 

بالتوفيق للجميع...^-^

 

ليست هناك تعليقات:

إرسال تعليق





1ZILLION Bath&BodyWorks H&M AliExpress Nike OudMilano Bangood Adidas NiseOne Mikyajy OUNASS GAP Udemy Nayomi H&M Bath&BodyWorks NICEONE